p2T-CAG-KKHSaCas9-BlastR
(Plasmid
#107189)
-
PurposeConfers constitutive expression of KKH SaCas9.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 107189 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonep2T-CAG-MCS-BlastR
-
Backbone manufacturerRichard Sherwood Lab
- Backbone size w/o insert (bp) 6637
- Total vector size (bp) 9898
-
Vector typeBacterial Expression
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameKKH SaCas9
-
Insert Size (bp)3261
-
MutationE782K/N968K/R1015H
-
Entrez GeneNEWENTRY
- Promoter Chicken ß-Actin
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NotI (destroyed during cloning)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer AAAACCTCCCACATCTCCCC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byMandana Arbab
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
p2T-CAG-KKHSaCas9-BlastR was a gift from Richard Sherwood (Addgene plasmid # 107189 ; http://n2t.net/addgene:107189 ; RRID:Addgene_107189) -
For your References section:
Predictable and precise template-free CRISPR editing of pathogenic variants. Shen MW, Arbab M, Hsu JY, Worstell D, Culbertson SJ, Krabbe O, Cassa CA, Liu DR, Gifford DK, Sherwood RI. Nature. 2018 Nov;563(7733):646-651. doi: 10.1038/s41586-018-0686-x. Epub 2018 Nov 7. 10.1038/s41586-018-0686-x PubMed 30405244