pJJB302
(Plasmid
#107694)
-
PurposeOsActin Promoter-LwaCas13a-HSP Terminator
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 107694 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepMOD_A
- Total vector size (bp) 7189
-
Vector typePlant Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCas13a
-
Alt nameC2c2
-
SpeciesDicot
- Promoter OsActin
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer GACAAATGCAGCCTCGTGCGG
- 3′ sequencing primer GTGCGATGAACCCCTATTTG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
This is a MOD_A plasmid compatible with the Cermek et al. toolkit.
https://www.addgene.org/browse/article/28189956/
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pJJB302 was a gift from Daniel Voytas (Addgene plasmid # 107694 ; http://n2t.net/addgene:107694 ; RRID:Addgene_107694) -
For your References section:
RNA targeting with CRISPR-Cas13. Abudayyeh OO, Gootenberg JS, Essletzbichler P, Han S, Joung J, Belanto JJ, Verdine V, Cox DBT, Kellner MJ, Regev A, Lander ES, Voytas DF, Ting AY, Zhang F. Nature. 2017 Oct 4. doi: 10.1038/nature24049. 10.1038/nature24049 PubMed 28976959