-
Purpose(Empty Backbone) pInducer20 with added blasticidin resistance
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 109334 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepIndcuer20-Blast
-
Vector typeMammalian Expression, Lentiviral ; Inducible expression
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol and Ampicillin, 25 & 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)ccdB Survival
-
Copy numberUnknown
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer CCATAGAAGACACCGGGACC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Addgene Notes
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pInducer20-Blast was a gift from Jean Cook (Addgene plasmid # 109334 ; http://n2t.net/addgene:109334 ; RRID:Addgene_109334) -
For your References section:
Rapid DNA replication origin licensing protects stem cell pluripotency. Matson JP, Dumitru R, Coryell P, Baxley RM, Chen W, Twaroski K, Webber BR, Tolar J, Bielinsky AK, Purvis JE, Cook JG. Elife. 2017 Nov 17;6. doi: 10.7554/eLife.30473. 10.7554/eLife.30473 PubMed 29148972