pCR1135
(Plasmid
#111103)
-
PurposeExpresses FANCE_-_35420147.23-P1P2 sgRNA in pCR1068
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 111103 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCR1068
-
Vector typeLentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameFANCE gRNA
-
gRNA/shRNA sequenceGGACAGCGCGGGAACGGCTG
-
SpeciesH. sapiens (human)
-
Entrez GeneFANCE (a.k.a. FACE, FAE)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Unknown (unknown if destroyed)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCR1135 was a gift from Jacob Corn (Addgene plasmid # 111103 ; http://n2t.net/addgene:111103 ; RRID:Addgene_111103) -
For your References section:
CRISPR-Cas9 genome editing in human cells occurs via the Fanconi anemia pathway. Richardson CD, Kazane KR, Feng SJ, Zelin E, Bray NL, Schafer AJ, Floor SN, Corn JE. Nat Genet. 2018 Aug;50(8):1132-1139. doi: 10.1038/s41588-018-0174-0. Epub 2018 Jul 27. 10.1038/s41588-018-0174-0 PubMed 30054595