pKLV2-EF1adCas9VP64T2ABsd-W
(Plasmid
#112919)
-
PurposeLentiviral vector expressing Lentiviral vector expressing Lentiviral vector expressing dCas9VP64 under the control of the long human EF1a promoter
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 112919 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepKLV2-EF1a-W
- Backbone size w/o insert (bp) 8000
- Total vector size (bp) 12854
-
Vector typeMammalian Expression, Lentiviral, CRISPR
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namedCas9VP64-T2A-Blast
-
SpeciesSynthetic; S. pyogenes
-
Insert Size (bp)4872
- Promoter Human EF1a promoter
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsiWI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer ATGTAATTCTCCTTGGAATTTG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pKLV2-EF1adCas9VP64T2ABsd-W was a gift from Kosuke Yusa (Addgene plasmid # 112919 ; http://n2t.net/addgene:112919 ; RRID:Addgene_112919) -
For your References section:
Pooled extracellular receptor-ligand interaction screening using CRISPR activation. Chong ZS, Ohnishi S, Yusa K, Wright GJ. Genome Biol. 2018 Nov 26;19(1):205. doi: 10.1186/s13059-018-1581-3. 10.1186/s13059-018-1581-3 PubMed 30477585