Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #112922)


Item Catalog # Description Quantity Price (USD)
Plasmid 112922 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone size w/o insert (bp) 2267
  • Total vector size (bp) 11063
  • Vector type
    Mammalian Expression ; Gateway entry vector
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy


  • Gene/Insert name
    EF1a promoter, dCas9VP94, MS2p65HSF1, IRESneo
  • Species
  • Insert Size (bp)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SalI (not destroyed)
  • 3′ cloning site SpeI (not destroyed)
  • 5′ sequencing primer ATGTAATTCTCCTTGGAATTTG
  • (Common Sequencing Primers)

Resource Information

  • Terms and Licenses
  • Industry Terms
    • Not Available to Industry
  • Article Citing this Plasmid
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pENTR-EF1adCas9VP64_T2A_MS2p65HSF1-IRESbsdpA was a gift from Kosuke Yusa (Addgene plasmid # 112922 ; ; RRID:Addgene_112922)
  • For your References section:

    Pooled extracellular receptor-ligand interaction screening using CRISPR activation. Chong ZS, Ohnishi S, Yusa K, Wright GJ. Genome Biol. 2018 Nov 26;19(1):205. doi: 10.1186/s13059-018-1581-3. 10.1186/s13059-018-1581-3 PubMed 30477585