-
PurposeTriple pathway reporter, 3P-Fluor; wnt-iRFP, hedgehog-mTurquoise2, notch-tdTomato; plus CMV-eGFP. Gateway expression vector for lentivirus generation.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 113865 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepMuLE Lenti Dest Neo
- Backbone size w/o insert (bp) 9237
- Total vector size (bp) 14704
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersNeomycin (select with G418) ; eGFP
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameCMV-eGFP
-
Insert Size (bp)1475
Cloning Information for Gene/Insert 1
- Cloning method Gateway Cloning
- 5′ sequencing primer AGGCAGGGATATTCACCATT (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameTOP-iRFP
-
Alt nameM50 Super 8x TOPFlash, promoter only
-
Alt nameiRFP713
-
Insert Size (bp)1315
Cloning Information for Gene/Insert 2
- Cloning method Gateway Cloning
- 5′ sequencing primer CAACAGCCACAACGTCTA (Common Sequencing Primers)
Gene/Insert 3
-
Gene/Insert namePTCH1-mTurquoise2
-
Alt namehPtch1 prom wt
-
Insert Size (bp)2295
Cloning Information for Gene/Insert 3
- Cloning method Gateway Cloning
- 5′ sequencing primer GAGCTAGTCGCCCAGGTTCT (Common Sequencing Primers)
Gene/Insert 4
-
Gene/Insert nameCBF-tdTomato
-
Alt nameCBFRE
-
Insert Size (bp)1961
Cloning Information for Gene/Insert 4
- Cloning method Gateway Cloning
- 5′ sequencing primer CCAGAAGTAGTGAGGAGGCTTT (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byBackbone is included in the MuLE kit, which was a gift from Ian Frew (Addgene kit #1000000060).
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMuLE_EXPR_CMV-eGFP_TOP-iRFP_PTCH1-mTurquoise2_CBF-tdTomato was a gift from Manfred Ogris (Addgene plasmid # 113865 ; http://n2t.net/addgene:113865 ; RRID:Addgene_113865) -
For your References section:
Luminescent and fluorescent triple reporter plasmid constructs for Wnt, Hedgehog and Notch pathway. Maier J, Elmenofi S, Taschauer A, Anton M, Sami H, Ogris M. PLoS One. 2019 Dec 20;14(12):e0226570. doi: 10.1371/journal.pone.0226570. eCollection 2019. 10.1371/journal.pone.0226570 PubMed 31860685