Skip to main content

CMV-VARNAM
(Plasmid #115552)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 115552 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    Modified pCAGGS
  • Backbone size w/o insert (bp) 4171
  • Total vector size (bp) 5554
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    VARNAM
  • Species
    Synthetic
  • Insert Size (bp)
    1383
  • Promoter CMV IE94
  • Tag / Fusion Protein
    • Golgi and ER export signal (C terminal on insert)

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer gacgtaaatgggcggtaggcgtg
  • 3′ sequencing primer tagccagaagtcagatgctcaagg
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    CMV-VARNAM was a gift from Vincent Pieribone (Addgene plasmid # 115552 ; http://n2t.net/addgene:115552 ; RRID:Addgene_115552)
  • For your References section:

    Fast, in vivo voltage imaging using a red fluorescent indicator. Kannan M, Vasan G, Huang C, Haziza S, Li JZ, Inan H, Schnitzer MJ, Pieribone VA. Nat Methods. 2018 Dec;15(12):1108-1116. doi: 10.1038/s41592-018-0188-7. Epub 2018 Nov 12. 10.1038/s41592-018-0188-7 PubMed 30420685