-
PurposeRed fluorescent voltage indicator for mammalian expression
-
Depositing Lab
-
Depositing OrganizationJohn B. Pierce Laboratory
Located in United States of America -
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 115552 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 115552-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 115552-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backboneModified pCAGGS
- Backbone size w/o insert (bp) 4171
- Total vector size (bp) 5554
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameVARNAM
-
SpeciesSynthetic
-
Insert Size (bp)1383
- Promoter CMV IE94
-
Tag
/ Fusion Protein
- Golgi and ER export signal (C terminal on insert)
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer gacgtaaatgggcggtaggcgtg
- 3′ sequencing primer tagccagaagtcagatgctcaagg
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 115552-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 115552-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
CMV-VARNAM was a gift from Vincent Pieribone (Addgene plasmid # 115552 ; http://n2t.net/addgene:115552 ; RRID:Addgene_115552) -
For your References section:
Fast, in vivo voltage imaging using a red fluorescent indicator. Kannan M, Vasan G, Huang C, Haziza S, Li JZ, Inan H, Schnitzer MJ, Pieribone VA. Nat Methods. 2018 Dec;15(12):1108-1116. doi: 10.1038/s41592-018-0188-7. Epub 2018 Nov 12. 10.1038/s41592-018-0188-7 PubMed 30420685
Map uploaded by the depositor.
