Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pCFD3.1-w-dU6:3gRNA
(Plasmid #123366)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 123366 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pCFD3-dU6-3gRNA (Addgene 49410)
  • Backbone manufacturer
    Fillip Port
  • Total vector size (bp) 7998
  • Modifications to backbone
    Replacement of vermilion transformation marker with mini-white gene (with BbsI sites mutated)
  • Vector type
    Insect Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    U6:3-gRNA
  • Alt name
    U6:3-sgRNA
  • Species
    D. melanogaster (fly)
  • GenBank ID

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Hind III (not destroyed)
  • 3′ cloning site KpnI (not destroyed)
  • 5′ sequencing primer CTGGCGAAAGGGGGATGTGCTG
  • 3′ sequencing primer TAAGGTATGCAGGTGTGTAAGTC
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    The modified mini-white cassette was provided by Dr Fillip Port from CRISPRflydesign, who has given permission for us to deposit this plasmid.
  • Articles Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

When describing the use of this plasmid in publications, please state that it is derived from pCFD3 and cite:

Port et al. Optimized CRISPR/Cas tools for efficient germline and somatic genome engineering in Drosophila. Proc Natl Acad Sci U S A. 2014 Jul 22;111(29):E2967-76. doi: 10.1073/pnas.1405500111

In pCFD3.1, the BbsI sites have been mutated in mini-white, which allows use of the remaining BbsI sites for gRNA cloning (using the protocol for pCFD3 (https://www.crisprflydesign.org/plasmids/)).

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCFD3.1-w-dU6:3gRNA was a gift from Simon Bullock (Addgene plasmid # 123366 ; http://n2t.net/addgene:123366 ; RRID:Addgene_123366)