-
Purpose3rd gen lentiviral expression of humanized ChR2 with H134R mutation fused to mCherry driven by EF1a promoter for optogenetic activation with puro selection
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 125256 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepLEX_307
-
Backbone manufacturerAddgene #41392 (provided by David Root)
- Backbone size w/o insert (bp) 8423
- Total vector size (bp) 10061
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namehChR2(H134R)
-
Alt nameChannelrhodopsin-2
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1638
- Promoter EF1a-forward
-
Tag
/ Fusion Protein
- mCherry (C terminal on insert)
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer TCAAGCCTCAGACAGTGGTTC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Addgene Notes
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLEX307-EF1a-ChR2[H134R]-mCherry-Puro-WPRE was a gift from Roger D. Kamm (Addgene plasmid # 125256 ; http://n2t.net/addgene:125256 ; RRID:Addgene_125256) -
For your References section:
Microphysiological 3D model of amyotrophic lateral sclerosis (ALS) from human iPS-derived muscle cells and optogenetic motor neurons. Osaki T, Uzel SGM, Kamm RD. Sci Adv. 2018 Oct 10;4(10):eaat5847. doi: 10.1126/sciadv.aat5847. eCollection 2018 Oct. 10.1126/sciadv.aat5847 PubMed 30324134