p1194-scAAV-U6-sgRNA_Nme2Cas9_Rosa26-CB-PI-AcrIIA4_FLAG_NLS
(Plasmid
#129532)
-
PurposeSelf-complementary AAV vector expressing Nme2Cas9 sgRNA targeting Rosa26 and AcrIIA4
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 129532 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonescAAV
- Total vector size (bp) 4934
-
Vector typeAAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert 1
-
Gene/Insert namecodon-optimized AcrIIA4
-
Insert Size (bp)261
- Promoter cytomegalovirus-enhancer chicken β-actin promoter with SV40-derived mini-intron
-
Tag
/ Fusion Protein
- FLAG/NLS (C terminal on insert)
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site AgeI (not destroyed)
- 3′ cloning site SacI (not destroyed)
- 5′ sequencing primer tacggtaaatggcccgcctg
- 3′ sequencing primer TAGAAGGCACAGTCGAGG
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namesgRNA_Rosa26
-
Insert Size (bp)145
- Promoter U6
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site MluI (not destroyed)
- 3′ cloning site MluI (not destroyed)
- 5′ sequencing primer CTCTAGGAAGATCAATTCGGTA
- 3′ sequencing primer GAGGGCCTATTTCCCATGATT
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
p1194-scAAV-U6-sgRNA_Nme2Cas9_Rosa26-CB-PI-AcrIIA4_FLAG_NLS was a gift from Erik Sontheimer (Addgene plasmid # 129532 ; http://n2t.net/addgene:129532 ; RRID:Addgene_129532) -
For your References section:
Tissue-restricted Genome Editing in vivo Specified by MicroRNA-repressible Anti-CRISPR Proteins. Lee J, Mou H, Ibraheim R, Liang SQ, Liu P, Xue W, Sontheimer EJ. RNA. 2019 Aug 22. pii: rna.071704.119. doi: 10.1261/rna.071704.119. 10.1261/rna.071704.119 PubMed 31439808