-
PurposeBacterial expression of uTEV3 (full-length) protease
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 135464 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepYFJ16
-
Backbone manufacturerJohn Cronan
- Backbone size w/o insert (bp) 4857
- Total vector size (bp) 6785
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsUse BL21(DE3)-RIL for protein expression. Shifting the temperature from 37C to 30C during induction maximizes the yield of soluble TEV protease. Ampicillin for His6-MBP-uTEV3; Chloramphenicol for pRIL.
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameHis6-MBP-uTEV3
-
SpeciesSynthetic
-
MutationS219V mutation (improves stability) , I138T/S153N/T180A mutations improve activity. Last 6 amino acids from TEV were deleted (237-242)
- Promoter T5
-
Tag
/ Fusion Protein
- MBP, His6
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GCTTTGTGAGCGGATAACAATTATAATAG
- 3′ sequencing primer CTGGCAAACGGTCGCCAGAGATCCGCG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
His6-MBP-uTEV3 was a gift from Alice Ting (Addgene plasmid # 135464 ; http://n2t.net/addgene:135464 ; RRID:Addgene_135464) -
For your References section:
Directed evolution improves the catalytic efficiency of TEV protease. Sanchez MI, Ting AY. Nat Methods. 2019 Dec 9. pii: 10.1038/s41592-019-0665-7. doi: 10.1038/s41592-019-0665-7. 10.1038/s41592-019-0665-7 PubMed 31819267