- 
            PurposetdTomato, StrepR, L5int, attP to create RFP mycobacteria
- 
              Depositing Lab
- 
          Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 140994 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
- 
            Vector backbonepMV361-strep
- 
              Vector typeBacterial Expression
Growth in Bacteria
- 
            Bacterial Resistance(s)Streptomycin, 50 μg/mL
- 
            Growth Temperature37°C
- 
            Growth Strain(s)DH5alpha
- 
            Copy numberUnknown
Gene/Insert
- 
                Gene/Insert nametdTomato
- 
                    SpeciesDiscosoma
- 
                    GenBank IDAAV52169
- Promoter hsp60
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (unknown if destroyed)
- 3′ cloning site HindIII (unknown if destroyed)
- 5′ sequencing primer GGCTTCTTGCACTCGGCATA (Common Sequencing Primers)
Resource Information
- 
            
            
            Supplemental Documents
- 
            A portion of this plasmid was derived from a plasmid made bytdTomato: Alex Speer pMV261-strep: Vincent van Winden
- 
            Articles Citing this Plasmid
Terms and Licenses
- 
        Academic/Nonprofit Terms
- 
      Industry Terms- Not Available to Industry
 
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
tdTomato: Improved monomeric red, orange and yellow fluorescent proteins derived from Discosoma sp. red fluorescent protein
Shaner Nc, Campbell Re, Steinbach Pa, Giepmans Bng, Palmer Ae, Tsien Ry
(2004). Nature Biotechnology, 22(12) , 1567-1572. doi: 10.1038/nbt1037.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
- 
              For your Materials & Methods section: pTdTomato-L5 was a gift from Wilbert Bitter (Addgene plasmid # 140994 ; http://n2t.net/addgene:140994 ; RRID:Addgene_140994)
- 
                For your References section: Efficient genome editing in pathogenic mycobacteria using Streptococcus thermophilus CRISPR1-Cas9. Meijers AS, Troost R, Ummels R, Maaskant J, Speer A, Nejentsev S, Bitter W, Kuijl CP. Tuberculosis (Edinb). 2020 Sep;124:101983. doi: 10.1016/j.tube.2020.101983. Epub 2020 Aug 12. 10.1016/j.tube.2020.101983 PubMed 32829077
 
    
