Skip to main content

pTdTomato-L5
(Plasmid #140994)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 140994 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pMV361-strep
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Streptomycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    tdTomato
  • Species
    Discosoma
  • GenBank ID
    AAV52169
  • Promoter hsp60

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (unknown if destroyed)
  • 3′ cloning site HindIII (unknown if destroyed)
  • 5′ sequencing primer GGCTTCTTGCACTCGGCATA
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    tdTomato: Alex Speer pMV261-strep: Vincent van Winden
  • Articles Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

tdTomato: Improved monomeric red, orange and yellow fluorescent proteins derived from Discosoma sp. red fluorescent protein
Shaner Nc, Campbell Re, Steinbach Pa, Giepmans Bng, Palmer Ae, Tsien Ry

(2004). Nature Biotechnology, 22(12) , 1567-1572. doi: 10.1038/nbt1037.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pTdTomato-L5 was a gift from Wilbert Bitter (Addgene plasmid # 140994 ; http://n2t.net/addgene:140994 ; RRID:Addgene_140994)
  • For your References section:

    Efficient genome editing in pathogenic mycobacteria using Streptococcus thermophilus CRISPR1-Cas9. Meijers AS, Troost R, Ummels R, Maaskant J, Speer A, Nejentsev S, Bitter W, Kuijl CP. Tuberculosis (Edinb). 2020 Sep;124:101983. doi: 10.1016/j.tube.2020.101983. Epub 2020 Aug 12. 10.1016/j.tube.2020.101983 PubMed 32829077