pMSP3545-dCas9Str
(Plasmid
#153516)
-
PurposeExpresses dCas9str under nisin-inducible nisA promoter in pMSP3545 backbone
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 153516 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepMSP3545
-
Backbone manufacturerGary Dunny
- Backbone size w/o insert (bp) 8514
- Total vector size (bp) 12621
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Erythromycin, 200 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namedCas9Str
-
Speciesinactivated dCas9 from Streptococcus pneumoniae
- Promoter nisA
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer cagcgagtcagtgagcgag
- 3′ sequencing primer cgcgagcataataaacggctc
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMSP3545-dCas9Str was a gift from Kimberly Kline (Addgene plasmid # 153516 ; http://n2t.net/addgene:153516 ; RRID:Addgene_153516) -
For your References section:
Multiplex CRISPRi System Enables the Study of Stage-Specific Biofilm Genetic Requirements in Enterococcus faecalis. Afonina I, Ong J, Chua J, Lu T, Kline KA. mBio. 2020 Oct 20;11(5):e01101-20. doi: 10.1128/mBio.01101-20. 10.1128/mBio.01101-20 PubMed 33082254