Skip to main content

pMSP3545-dCas9Str
(Plasmid #153516)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 153516 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pMSP3545
  • Backbone manufacturer
    Gary Dunny
  • Backbone size w/o insert (bp) 8514
  • Total vector size (bp) 12621
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Erythromycin, 200 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    dCas9Str
  • Species
    inactivated dCas9 from Streptococcus pneumoniae
  • Promoter nisA

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer cagcgagtcagtgagcgag
  • 3′ sequencing primer cgcgagcataataaacggctc
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMSP3545-dCas9Str was a gift from Kimberly Kline (Addgene plasmid # 153516 ; http://n2t.net/addgene:153516 ; RRID:Addgene_153516)
  • For your References section:

    Multiplex CRISPRi System Enables the Study of Stage-Specific Biofilm Genetic Requirements in Enterococcus faecalis. Afonina I, Ong J, Chua J, Lu T, Kline KA. mBio. 2020 Oct 20;11(5):e01101-20. doi: 10.1128/mBio.01101-20. 10.1128/mBio.01101-20 PubMed 33082254