pGCP123-GFP_g1
(Plasmid
#153518)
-
PurposesgRNA to GFP gene (NT) under nisin-inducible nisA promoter, barcoded
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 153518 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepGCP123
-
Backbone manufacturerNielsen et at mBio. 2012 Jul 24;3(4):e00177-12. doi: 10.1128/mBio.00177-12.
- Backbone size w/o insert (bp) 2917
- Total vector size (bp) 3182
-
Vector typeBacterial Expression, CRISPR, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsLB kan 50 (E. coli, grow for 48 hours) BHI Kan 500 (E. faecalis)
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namePnisA-sgRNA(GFP_g1)_dCas9 scaffold (barcoded)
-
gRNA/shRNA sequencecatctaattcaacaagaatt
-
SpeciesEnterococcus faecalis
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer gBlock sequence ready for InFusion
- 3′ sequencing primer gBlock sequence ready for InFusion (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGCP123-GFP_g1 was a gift from Kimberly Kline (Addgene plasmid # 153518 ; http://n2t.net/addgene:153518 ; RRID:Addgene_153518) -
For your References section:
Multiplex CRISPRi System Enables the Study of Stage-Specific Biofilm Genetic Requirements in Enterococcus faecalis. Afonina I, Ong J, Chua J, Lu T, Kline KA. mBio. 2020 Oct 20;11(5):e01101-20. doi: 10.1128/mBio.01101-20. 10.1128/mBio.01101-20 PubMed 33082254