Skip to main content

pENTR2b-mVenus
(Plasmid #154898)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 154898 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pENTR2b
  • Backbone size (bp) 2718
  • Vector type
    Entry vector

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ sequencing primer TACTTAAGCTCGGGCCCCAA
  • 3′ sequencing primer CCTGTTCGTTGCAACAAATTGA
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pENTR2b-mVenus was a gift from Johanna Ivaska (Addgene plasmid # 154898 ; http://n2t.net/addgene:154898 ; RRID:Addgene_154898)
  • For your References section:

    A feed-forward loop between SorLA and HER3 determines heregulin response and neratinib resistance. Al-Akhrass H, Conway JRW, Poulsen ASA, Paatero I, Kaivola J, Padzik A, Andersen OM, Ivaska J. Oncogene. 2021 Feb;40(7):1300-1317. doi: 10.1038/s41388-020-01604-5. Epub 2021 Jan 8. 10.1038/s41388-020-01604-5 PubMed 33420373