pENTR2b-mVenus
(Plasmid
#154898)
-
Purpose(Empty Backbone) mVenus entry vector
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 154898 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepENTR2b
- Backbone size (bp) 2718
-
Vector typeEntry vector
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Cloning Information
- Cloning method Restriction Enzyme
- 5′ sequencing primer TACTTAAGCTCGGGCCCCAA
- 3′ sequencing primer CCTGTTCGTTGCAACAAATTGA (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pENTR2b-mVenus was a gift from Johanna Ivaska (Addgene plasmid # 154898 ; http://n2t.net/addgene:154898 ; RRID:Addgene_154898) -
For your References section:
A feed-forward loop between SorLA and HER3 determines heregulin response and neratinib resistance. Al-Akhrass H, Conway JRW, Poulsen ASA, Paatero I, Kaivola J, Padzik A, Andersen OM, Ivaska J. Oncogene. 2021 Feb;40(7):1300-1317. doi: 10.1038/s41388-020-01604-5. Epub 2021 Jan 8. 10.1038/s41388-020-01604-5 PubMed 33420373