PB-TRE-dCas9-VPR-pA-3xsgRNA-EF1a-Tet.O-T2A-PuroR-polyA
(Plasmid
#166693)
-
PurposeExpress dCas9-VPR in a doxycyclin-inducable system and 3 sgRNAs targeting the murine Cnga1 promoter. Can be stably integrated into the genome via the PiggyBac Transposon system.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 166693 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonePiggyBac
- Backbone size w/o insert (bp) 7250
- Total vector size (bp) 14555
-
Vector typeMammalian Expression, CRISPR
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert 1
-
Gene/Insert namedCas9-VPR
-
SpeciesStreptococcus pyogenes
-
Insert Size (bp)7300
- Promoter TRE
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site Eco105I (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer cgtaccacttcctaccctcg
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert name3x Cnga1 promoter-targeting sgRNAs
-
SpeciesStreptococcus pyogenes
- Promoter U6
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site XmaJI (not destroyed)
- 3′ cloning site PacI (not destroyed)
- 5′ sequencing primer GCGGCAGGCCCTGCCATAGC
- 3′ sequencing primer ACACAAAAAACCAACACACAGA
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made bySP-dCas9-VPR, Addgene plasmid 63798
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
PB-TRE-dCas9-VPR-pA-3xsgRNA-EF1a-Tet.O-T2A-PuroR-polyA was a gift from Elvir Becirovic (Addgene plasmid # 166693 ; http://n2t.net/addgene:166693 ; RRID:Addgene_166693) -
For your References section:
A gene therapy for inherited blindness using dCas9-VPR-mediated transcriptional activation. Bohm S, Splith V, Riedmayr LM, Rotzer RD, Gasparoni G, Nordstrom KJV, Wagner JE, Hinrichsmeyer KS, Walter J, Wahl-Schott C, Fenske S, Biel M, Michalakis S, Becirovic E. Sci Adv. 2020 Aug 19;6(34):eaba5614. doi: 10.1126/sciadv.aba5614. eCollection 2020 Aug. 10.1126/sciadv.aba5614 PubMed 32875106