Skip to main content

GalT-RpHLuorin2
(Plasmid #171719)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 171719 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pRpHluorin-N1
  • Backbone manufacturer
    Clontech
  • Backbone size w/o insert (bp) 4730
  • Modifications to backbone
    The starting codon of RpHLuorin2 was removed and a flexible GGSGGS linker was added between the two protein fragments.
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Ratiometric pHLuorin2 fused to B4GALT1
  • Alt name
    B4GAL-T1, CDG2D, GGTB2, GT1, GTB, beta4Gal-T1, GalT
  • Species
    H. sapiens (human)
  • GenBank ID
    NM_001497.3
  • Entrez Gene
    B4GALT1 (a.k.a. B4GAL-T1, CDG2D, CLDLFIB, GGTB2, GT1, GTB, beta4Gal-T1)
  • Promoter CMV
  • Tag / Fusion Protein
    • ratiometric pHluorin2 (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SmaI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer TAACAACTCCGCCCCATT
  • 3′ sequencing primer GTCCAGCTCGACCAGGATGGG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Truncated GalT was cloned from Addgene plasmid #87325
  • Articles Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Ratiometric pHLuorin2 sequence synthesized by Genscript, original sequence from https://www.scirp.org/journal/paperinformation.aspx?paperid=5043

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    GalT-RpHLuorin2 was a gift from Geert van den Bogaart (Addgene plasmid # 171719 ; http://n2t.net/addgene:171719 ; RRID:Addgene_171719)
  • For your References section:

    Fluorescence Lifetime Imaging of pH along the Secretory Pathway. Linders PTA, Ioannidis M, Ter Beest M, van den Bogaart G. ACS Chem Biol. 2022 Jan 21;17(1):240-251. doi: 10.1021/acschembio.1c00907. Epub 2022 Jan 10. 10.1021/acschembio.1c00907 PubMed 35000377