GalT-RpHLuorin2
(Plasmid #171719)

• Purpose: Trans-Golgi expression of ratiometric pHLuorin2
• Depositing Lab: Geert van den Bogaart
• Depositing Organization: University of Groningen
  Located in Netherlands
• Publication: Linders et al ACS Chem Biol. 2022 Jan 21;17(1):240-251. doi: 10.1021/acschembio.1c00907. Epub 2022 Jan 10.
• Citations: 2 Articles

Backbone

• Vector backbone: pRpHluorin-N1
• Backbone manufacturer: Clontech
• Backbone size w/o insert (bp): 4730
• Modifications to backbone: The starting codon of RpHLuorin2 was removed and a flexible GGSGGS linker was added between the two protein fragments.
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Ratiometric pHLuorin2 fused to B4GALT1
• Alt name: B4GAL-T1, CDG2D, GGTB2, GT1, GTB, beta4Gal-T1, GalT
• Species: H. sapiens (human)
• GenBank ID: NM_001497.3
• Entrez Gene: B4GALT1 (a.k.a. B4GAL-T1, CDG2D, CLDLFIB, GGTB2, GT1, GTB, beta4Gal-T1)
• Promoter: CMV
• Tag / Fusion Protein:
  • ratiometric pHluorin2 (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: SmaI (not destroyed)
• 3′ cloning site: BamHI (not destroyed)
• 5′ sequencing primer: TAACAACTCCGCCCCATT
• 3′ sequencing primer: GTCCAGCTCGACCAGGATGGG

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Truncated GalT was cloned from Addgene plasmid #87325

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Ratiometric pHLuorin2 sequence synthesized by Genscript, original sequence from https://www.scirp.org/journal/paperinformation.aspx?paperid=5043

DNA (Catalog # 171719-D50)

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

• Amount: 50 μg
• Concentration: 1 μg/μL
• Pricing: $495 USD
• Storage: 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

DNA (Catalog # 171719-D100)

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

• Amount: 100 μg
• Concentration: 1 μg/μL
• Pricing: $585 USD
• Storage: 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.