pCMV-Spike
(Plasmid #173921)

• Purpose: Expresses the original SARS-Cov-2 Spike Protein under a CMV Promoter
• Depositing Lab: Andreas Stuermer
• Publication: Plasmids expressing the original SARS-Coronavirus 2 Spike Protein (unpublished)

Backbone

• Vector backbone: pUC57-Kan
• Backbone size w/o insert (bp): 2539
• Total vector size (bp): 7286
• Modifications to backbone: none, EcoRV serves as blunt cutter on both ends if integration is desired. LoxP is included for rapid knock-in, after EcoRV digest and re-circularization
• Vector type: Mammalian Expression, Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Growth instructions: LB medium with kanamycin
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: SARS-2 Spike Protein
• Species: H. sapiens (human), Synthetic; SARS-COV-2
• Insert Size (bp): 4747
• Entrez Gene: S (a.k.a. GU280_gp02, spike glycoprotein)
• Promoter: standard CMV
• Tag / Fusion Protein:
  • no tags, native protein

Cloning Information

• Cloning method: Unknown
• 5′ sequencing primer: CMV-f CGCAAATGGGCGGTAGGCGTG
• 3′ sequencing primer: M13-rev CAGGAAACAGCTATGAC

Resource Information

• Supplemental Documents:
  • pCMV-Spike in pUC57-KAN we have.gb
• A portion of this plasmid was derived from a plasmid made by: Synthetic Insert

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Industry MTA