pBAD_sfGFP3TCG4TAG
(Plasmid
#174518)
-
PurposeRecoded sfGFP reporter with the codons TCG and TAG inserted at positions 3 and 4, respectively.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 174518 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepBAD
- Backbone size w/o insert (bp) 3896
- Total vector size (bp) 4646
-
Modifications to backboneThe entire backbone was recoded according to the genome of Syn61. AmpR gene was replaced by ApmR (Apramycin)
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Apramycin, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namesfGFP
-
Insert Size (bp)750
-
MutationRecoded. TCG and TAG codons were introduced in positions 3 and 4
- Promoter araBAD
-
Tag
/ Fusion Protein
- 6 x His (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer ATGCCATAGCATTTTTATCC
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byThe original sfGFP sequence was published in: Pédelacq JD, Cabantous S, Tran T, Terwilliger TC, Waldo GS. Engineering and characterization of a superfolder green fluorescent protein. Nat Biotechnol. 2006;24:79-88.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pBAD_sfGFP3TCG4TAG was a gift from Jason W Chin (Addgene plasmid # 174518 ; http://n2t.net/addgene:174518 ; RRID:Addgene_174518) -
For your References section:
Sense codon reassignment enables viral resistance and encoded polymer synthesis. Robertson WE, Funke LFH, de la Torre D, Fredens J, Elliott TS, Spinck M, Christova Y, Cervettini D, Boge FL, Liu KC, Buse S, Maslen S, Salmond GPC, Chin JW. Science. 2021 Jun 4;372(6546):1057-1062. doi: 10.1126/science.abg3029. 10.1126/science.abg3029 PubMed 34083482