pAAV-4mtD3cpv
(Plasmid
#181874)
-
PurposeExpresses the FRET-based mitochondrial calcium indicator 4mtD3cpv under control of the CaMKIIa promoter
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 181874 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepAAV-CKIIa
-
Vector typeMammalian Expression, Adenoviral, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert name4mtD3cpv
-
Alt namemitochondrially targeted, FRET-based calcium indicator
-
SpeciesSynthetic
-
Insert Size (bp)2352
-
Mutationthe 4mtD3cpv CDS differs from the recorded GeneBank sequence in that it lacks amino acids 65-66
-
GenBank IDDQ479429.1
- Promoter CaMKIIa
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AgeI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer TGGGGACCTGGATGCTGACGAA
- 3′ sequencing primer ACGGGAAGCAATAGCATGATAC
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-4mtD3cpv was a gift from Hilmar Bading (Addgene plasmid # 181874 ; http://n2t.net/addgene:181874 ; RRID:Addgene_181874) -
For your References section:
Disrupted expression of mitochondrial NCLX sensitizes neuroglial networks to excitotoxic stimuli and renders synaptic activity toxic. Hagenston AM, Yan J, Bas-Orth C, Tan Y, Sekler I, Bading H. J Biol Chem. 2021 Dec 20:101508. doi: 10.1016/j.jbc.2021.101508. 10.1016/j.jbc.2021.101508 PubMed 34942149