pAAV-hSyn-hM3D(Gq)::RAM-d2tTA
(Plasmid
#189627)
-
PurposeExpresses hM3D(Gq) under the hSyn promoter, and d2tTA under the pRAM (synthetic Fos) promoter. Plasmid 1 for recording Fos expression.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 189627 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepAAV
- Backbone size w/o insert (bp) 3659
- Total vector size (bp) 7292
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert 1
-
Gene/Insert namehM3D(Gq)
-
Alt namehM3Dq
-
SpeciesH. sapiens (human)
- Promoter hSyn
-
Tag
/ Fusion Protein
- HA (N terminal on insert)
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer tcagcgctgcctcagtct (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert named2tTA
-
Alt nametetracycline-controlled transactivator
- Promoter pRAM
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer ggctgttgggcactgacaat
- 3′ sequencing primer taatacgactcactataggg (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
hSyn-hM3D(Gq) is derived from pAAV-hSyn-hM3D(Gq)-mCherry (Addgene #50474).
RAM-d2tTA is derived from pAAV-RAM-d2TTA::TRE-MCS-WPRE-pA (Addgene #63931).
Please visit https://www.biorxiv.org/content/10.1101/2022.07.17.500352v1 for BioRxiv preprint
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-hSyn-hM3D(Gq)::RAM-d2tTA was a gift from Jerzy Szablowski (Addgene plasmid # 189627 ; http://n2t.net/addgene:189627 ; RRID:Addgene_189627) -
For your References section:
Engineered serum markers for non-invasive monitoring of gene expression in the brain. Lee S, Nouraein S, Kwon JJ, Huang Z, Wojick JA, Xia B, Corder G, Szablowski JO. Nat Biotechnol. 2024 Jan 10. doi: 10.1038/s41587-023-02087-x. 10.1038/s41587-023-02087-x PubMed 38200117