pCDH-EFS-FlpO
(Plasmid
#191509)
-
PurposeLentiviral Flp Recombinase driven by the EFS promoter
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 191509 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepCDH
- Total vector size (bp) 7437
-
Modifications to backboneEFS promoter driving FlpO expression
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameflp recombinase
-
Alt nameEFS promoter driving FlpO recombinase
-
Insert Size (bp)212
-
Entrez Geneflp
- Promoter EF1a/EFS promoter inserted
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SnaI (destroyed during cloning)
- 3′ cloning site XbaI (not destroyed)
- 5′ sequencing primer ccagtacatgaccttatggg
- 3′ sequencing primer GATGTCGAACTGGCTCAT (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byWe replaced the CMV promoter from pCDH-CMV-FlpO (Camolotto et al 2018) with an EF1a/EFS promoter from the pCDH-Cre plasmid (Han et al 2014)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCDH-EFS-FlpO was a gift from Eric Snyder (Addgene plasmid # 191509 ; http://n2t.net/addgene:191509 ; RRID:Addgene_191509) -
For your References section:
FoxA1 and FoxA2 control growth and cellular identity in NKX2-1-positive lung adenocarcinoma. Orstad G, Fort G, Parnell TJ, Jones A, Stubben C, Lohman B, Gillis KL, Orellana W, Tariq R, Klingbeil O, Kaestner K, Vakoc CR, Spike BT, Snyder EL. Dev Cell. 2022 Aug 8;57(15):1866-1882.e10. doi: 10.1016/j.devcel.2022.06.017. Epub 2022 Jul 13. 10.1016/j.devcel.2022.06.017 PubMed 35835117