Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
As of April 1, 2023, we increased some of our prices. See the new prices and get more information or speak with our friendly support team.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pHAGE2-TetOminiCMV-Oct4-p2a-Sox2-17-t2a-Klf4
(Plasmid #193345)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 193345 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pHAGE2
  • Backbone size w/o insert (bp) 6247
  • Total vector size (bp) 10102
  • Vector type
    Mammalian Expression, Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Oct4-p2a-Sox2-17-t2a-Klf4
  • Alt name
    Pou5f1
  • Alt name
    superSox
  • Alt name
    Klf4
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    3209
  • Mutation
    Sox2-17 is engineered highly cooperative chimeric transcription factor, where the following elements of Sox2 were swapped with Sox17: 43-47, 61, 65-86 and CTD
  • Entrez Gene
    Klf4 (a.k.a. EZF, Gklf, Zie)
  • Entrez Gene
    Pou5f1 (a.k.a. NF-A3, Oct-3, Oct-3/4, Oct-4, Oct3, Oct3/4, Oct4, Otf-3, Otf-4, Otf3, Otf3-rs7, Otf3g, Otf4)
  • Entrez Gene
    Sox2 (a.k.a. Sox-2, lcc, ysb)
  • Promoter TetO mini CMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NotI (additional NotI site is present in Sox2-17 sequence) (not destroyed)
  • 3′ cloning site ClaI (not destroyed)
  • 5′ sequencing primer gagacgccatccacgctgt
  • 3′ sequencing primer AGGAAGGTCCGCTGGATTGA
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pHAGE2-TetOminiCMV-Oct4-p2a-Sox2-17-t2a-Klf4 was a gift from Hans Schöler (Addgene plasmid # 193345 ; http://n2t.net/addgene:193345 ; RRID:Addgene_193345)
  • For your References section:

    Enhancing Sox/Oct cooperativity induces higher-grade developmental reset. MacCarthy CM, Malik V, Wu G, Velychko T, Keshet G, Jauch R, Cojocaru V, Schöler HR, Velychko S. bioRxiv 2022.09.23.509242 10.1101/2022.09.23.509242