-
PurposePer2 promoter luciferase reporter
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 206875 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepMA3160
-
Backbone manufacturerAlexeyev Lab
- Backbone size w/o insert (bp) 8331
- Total vector size (bp) 8519
-
Modifications to backboneInserted a Per2 promoter gene upstream of the luciferase gene.
-
Vector typeMammalian Expression, Lentiviral, Luciferase
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namePeriod 2
-
Alt namePer2
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)208
-
Entrez GenePer2 (a.k.a. mKIAA0347, mPer2)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer GAATTCAGCGTAGCTCTCAGGTTCCG
- 3′ sequencing primer CCTTATGCAGTTGCTCTCC
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
For generation of PER2-luciferase (PER2:Luc) plasmid, a 159-bp EcoRI/NotI fragment was isolated from a pGL3 basic PER2 construct, obtained from Addgene (plasmid #48747, deposited by Dr Joseph Takahashi). The PER2 promoter-containing fragment was subcloned into the lentiviral construct pMA3160 (Addgene plasmid #35043, deposited by Dr Mikhail Alexeyev) to generate a PER2-luciferase reporter construct.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
PER2:Luc Plasmid was a gift from Michelle Farkas (Addgene plasmid # 206875 ; http://n2t.net/addgene:206875 ; RRID:Addgene_206875) -
For your References section:
Analyses of BMAL1 and PER2 Oscillations in a Model of Breast Cancer Progression Reveal Changes With Malignancy. Lin HH, Qraitem M, Lian Y, Taylor SR, Farkas ME. Integr Cancer Ther. 2019 Jan-Dec;18:1534735419836494. doi: 10.1177/1534735419836494. 10.1177/1534735419836494 PubMed 30943793