Skip to main content

pLKO.1 Rheb1 shRNA #2
(Plasmid #26626)

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 26626 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pLKO.1 puro
  • Backbone manufacturer
    Available at Addgene (#8453)
  • Backbone size w/o insert (bp) 7000
  • Vector type
    Mammalian Expression, Lentiviral, RNAi
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Rheb1 shRNA
  • Alt name
    Rheb1
  • gRNA/shRNA sequence
    TTATGTTGGTTGGGAATAAGA
  • Species
    H. sapiens (human)
  • Entrez Gene
    RHEB (a.k.a. RHEB2)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (unknown if destroyed)
  • 3′ cloning site EcoRI (unknown if destroyed)
  • 5′ sequencing primer LKO.1 5'
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

shRNA directed against Rheb1. Target sequence: 5'-TTATGTTGGTTGGGAATAAGA-3'.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLKO.1 Rheb1 shRNA #2 was a gift from David Sabatini (Addgene plasmid # 26626 ; http://n2t.net/addgene:26626 ; RRID:Addgene_26626)
  • For your References section:

    The Rag GTPases bind raptor and mediate amino acid signaling to mTORC1. Sancak Y, Peterson TR, Shaul YD, Lindquist RA, Thoreen CC, Bar-Peled L, Sabatini DM. Science. 2008 Jun 13. 320(5882):1496-501. 10.1126/science.1157535 PubMed 18497260