-
PurposeConditional overexpression vector. Deletion of dsRed by Cre recombinase results in the rapid loss of dsRed and the activation of your gene fused to eGFP expression.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 32702 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backboneMSCV
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 6295
-
Modifications to backboneloxp-dsRed-loxp-MCS-eGFP seq is inserted.
-
Vector typeMammalian Expression, Retroviral, Cre/Lox
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Growth instructionsThe depositor notes that XL1-Blue is also ok for general purpose use.
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameeGFP
-
Insert Size (bp)720
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer CTCCCACAACGAGGACTACAC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMSCV-loxp-dsRed-loxp-eGFP-Puro-WPRE was a gift from Hans Clevers (Addgene plasmid # 32702 ; http://n2t.net/addgene:32702 ; RRID:Addgene_32702) -
For your References section:
Controlled gene expression in primary Lgr5 organoid cultures. Koo BK, Stange DE, Sato T, Karthaus W, Farin HF, Huch M, van Es JH, Clevers H. Nat Methods. 2011 Dec 4. doi: 10.1038/nmeth.1802. 10.1038/nmeth.1802 PubMed 22138822