Skip to main content

tol2-mpx-cxcr4b whim-gfp
(Plasmid #41089)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 41089 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    tol2
  • Backbone size w/o insert (bp) 3000
  • Total vector size (bp) 13300
  • Modifications to backbone
    added mpx promoter, truncated cxcr4b, and EGFP
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    CXCR4b-WHIM
  • Species
    D. rerio (zebrafish)
  • Insert Size (bp)
    1002
  • Mutation
    deleted last 19 amino acids of cxcr4b
  • Entrez Gene
    cxcr4b (a.k.a. CXCR4, cb403, zgc:109863)
  • Promoter mpx
  • Tag / Fusion Protein
    • GFP (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site MluI (unknown if destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer ccaggtcattgcacaacaccag
  • 3′ sequencing primer gttatccgctcacaattccacac
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    tol2-mpx-cxcr4b whim-gfp was a gift from Anna Huttenlocher (Addgene plasmid # 41089 ; http://n2t.net/addgene:41089 ; RRID:Addgene_41089)
  • For your References section:

    Live imaging of neutrophil motility in a zebrafish model of WHIM syndrome. Walters KB, Green JM, Surfus JC, Yoo SK, Huttenlocher A. Blood. 2010 Oct 14;116(15):2803-11. Epub 2010 Jun 30. 10.1182/blood-2010-03-276972 PubMed 20592249