Skip to main content

mpx:UtrCH-GFP
(Plasmid #45247)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 45247 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    tol2:mpx-gfp
  • Backbone size w/o insert (bp) 12500
  • Total vector size (bp) 13442
  • Modifications to backbone
    inserted utrophin
  • Vector type
    zebrafish expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    utrophin
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    700
  • Mutation
    contains amino acids 1-261 of NP_009055.2; Q236R
  • Entrez Gene
    UTRN (a.k.a. DMDL, DRP, DRP1)
  • Promoter mpx
  • Tag / Fusion Protein
    • EGFP (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site NcoI (not destroyed)
  • 5′ sequencing primer TAGGGATCCGGTAGGCGTGTA
  • 3′ sequencing primer tgaacagctcctcgccctt
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    the original plasmid is a generous gift from W. Bement(Burkel et al., 2007)

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    mpx:UtrCH-GFP was a gift from Anna Huttenlocher (Addgene plasmid # 45247 ; http://n2t.net/addgene:45247 ; RRID:Addgene_45247)
  • For your References section:

    Differential regulation of protrusion and polarity by PI3K during neutrophil motility in live zebrafish. Yoo SK, Deng Q, Cavnar PJ, Wu YI, Hahn KM, Huttenlocher A. Dev Cell. 2010 Feb 16. 18(2):226-36. 10.1016/j.devcel.2009.11.015 PubMed 20159593