mpx:UtrCH-GFP
(Plasmid
#45247)
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 45247 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonetol2:mpx-gfp
- Backbone size w/o insert (bp) 12500
- Total vector size (bp) 13442
-
Modifications to backboneinserted utrophin
-
Vector typezebrafish expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameutrophin
-
SpeciesH. sapiens (human)
-
Insert Size (bp)700
-
Mutationcontains amino acids 1-261 of NP_009055.2; Q236R
-
Entrez GeneUTRN (a.k.a. DMDL, DRP, DRP1)
- Promoter mpx
-
Tag
/ Fusion Protein
- EGFP (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site NcoI (not destroyed)
- 5′ sequencing primer TAGGGATCCGGTAGGCGTGTA
- 3′ sequencing primer tgaacagctcctcgccctt (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made bythe original plasmid is a generous gift from W. Bement(Burkel et al., 2007)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
mpx:UtrCH-GFP was a gift from Anna Huttenlocher (Addgene plasmid # 45247 ; http://n2t.net/addgene:45247 ; RRID:Addgene_45247) -
For your References section:
Differential regulation of protrusion and polarity by PI3K during neutrophil motility in live zebrafish. Yoo SK, Deng Q, Cavnar PJ, Wu YI, Hahn KM, Huttenlocher A. Dev Cell. 2010 Feb 16. 18(2):226-36. 10.1016/j.devcel.2009.11.015 PubMed 20159593