-
PurposepJH136 carries a URA3 cassette flanked by PCR priming sites U2 and D2. URA3 was derived from S288c and extends from 243 bp upstream of the start codon to 79 bp downstream of the stop codon.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 47554 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepPCR-Script Amp SK(+)
-
Backbone manufacturerAgilent Technologies
- Backbone size w/o insert (bp) 2961
- Total vector size (bp) 4121
-
Vector typePCR template
-
Selectable markersURA3
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameURA3
-
SpeciesS. cerevisiae (budding yeast)
-
Insert Size (bp)1160
- Promoter Native URA3 promoter, -243 to -1.
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SrfI (destroyed during cloning)
- 3′ cloning site SrfI (destroyed during cloning)
- 5′ sequencing primer GTTGTAAAACGACGGCCAGT
- 3′ sequencing primer TCACACAGGAAACAGCTATGA (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Primer sequences (5' to 3'): U2, CGTACGCTGCAGGTCGAC; D2, ATCGATGAATTCGAGCTCG.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pJH136 was a gift from Ronald Davis (Addgene plasmid # 47554 ; http://n2t.net/addgene:47554 ; RRID:Addgene_47554) -
For your References section:
The 50:50 method for PCR-based seamless genome editing in yeast. Horecka J, Davis RW. Yeast. 2014 Mar;31(3):103-12. doi: 10.1002/yea.2992. Epub 2013 Dec 13. 10.1002/yea.2992 PubMed 24639370