-
PurposeHuman codon optimized Cas9 nuclease from Streptococcus pyogenes (Cbh-3X-FLAG-NLS-SpCas9-NLS)
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 48137 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonePX165
- Total vector size (bp) 8300
-
Vector typeMammalian Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namehSpCas9
-
Alt nameSpCas9
-
Alt nameCas9
-
Alt namePX165
-
SpeciesSynthetic
-
Insert Size (bp)5400
- Promoter Cbh
-
Tag
/ Fusion Protein
- 3XFLAG (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AgeI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer CTGGAGCACCTGCCTGAAATCACT (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
For more information on Zhang Lab CRISPR Plasmids please refer to: http://www.addgene.org/crispr/zhang/.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSpCas9 (PX165) was a gift from Feng Zhang (Addgene plasmid # 48137 ; http://n2t.net/addgene:48137 ; RRID:Addgene_48137) -
For your References section:
Genome engineering using the CRISPR-Cas9 system. Ran FA, Hsu PD, Wright J, Agarwala V, Scott DA, Zhang F. Nat Protoc. 2013 Nov;8(11):2281-308. doi: 10.1038/nprot.2013.143. Epub 2013 Oct 24. 10.1038/nprot.2013.143 PubMed 24157548