pET29b-ClbPpep-CHis
(Plasmid
#48243)
-
PurposeFirst 375 amino acids of the peptidase, which contains the soluble periplasmic peptidase domain
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 48243 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepET29b-(+)
-
Backbone manufacturerNovagen
- Backbone size w/o insert (bp) 5370
- Total vector size (bp) 6363
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Top10
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameClbP-pep
-
SpeciesEscherichia coli CFT073
-
Insert Size (bp)1131
-
MutationFirst 375 amino acids of the peptidase, which contains the soluble periplasmic peptidase domain
-
GenBank IDNP_754344.1
- Promoter T7
-
Tag
/ Fusion Protein
- 6-His (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NdeI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer AATACATATGACAATAATGGAACACGTTAG
- 3′ sequencing primer ATTACTCGAGATATTTGCCAATGCGCAG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pET29b-ClbPpep-CHis was a gift from Emily Balskus (Addgene plasmid # 48243 ; http://n2t.net/addgene:48243 ; RRID:Addgene_48243) -
For your References section:
A prodrug resistance mechanism is involved in colibactin biosynthesis and cytotoxicity. Brotherton CA, Balskus EP. J Am Chem Soc. 2013 Mar 6;135(9):3359-62. doi: 10.1021/ja312154m. Epub 2013 Feb 20. 10.1021/ja312154m PubMed 23406518