-
PurposeBackbone: pBbB5c Origin Of Replication:pBBR1 Selection Markers: Chloramphenicol Promoters: PLacUV5
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 50596 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepBbB5c
-
Vector typeBacterial Expression, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH10B
-
Copy numberUnknown
Gene/Insert 1
-
Gene/Insert namearoE
-
Insert Size (bp)810
- Promoter lacUV5
Cloning Information for Gene/Insert 1
- Cloning method Unknown
- 5′ sequencing primer TAATGATCAGCCCACTGACG
- 3′ sequencing primer CATGGATGGCCTCCTTTAGA (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namearoD
-
Insert Size (bp)758
- Promoter lacUV5
Cloning Information for Gene/Insert 2
- Cloning method Unknown
- 5′ sequencing primer TAATGATCAGCCCACTGACG
- 3′ sequencing primer AGAGTAACGACAATACGCTCCA (Common Sequencing Primers)
Gene/Insert 3
-
Gene/Insert namearoB
-
Insert Size (bp)1088
- Promoter lacUV5
Cloning Information for Gene/Insert 3
- Cloning method Unknown
- 5′ sequencing primer TAATGATCAGCCCACTGACG
- 3′ sequencing primer GTATTCGCGGCATTTTCAGT (Common Sequencing Primers)
Gene/Insert 4
-
Gene/Insert namearoG*
-
Insert Size (bp)1052
- Promoter lacUV5
Cloning Information for Gene/Insert 4
- Cloning method Unknown
- 5′ sequencing primer TAATGATCAGCCCACTGACG
- 3′ sequencing primer CCGTTTTATCCAGCAGTTCA (Common Sequencing Primers)
Gene/Insert 5
-
Gene/Insert nameppsA
-
Insert Size (bp)2378
- Promoter lacUV5
Cloning Information for Gene/Insert 5
- Cloning method Unknown
- 5′ sequencing primer TAATGATCAGCCCACTGACG
- 3′ sequencing primer NA (Common Sequencing Primers)
Gene/Insert 6
-
Gene/Insert nametktA
-
Insert Size (bp)1991
- Promoter lacUV5
Cloning Information for Gene/Insert 6
- Cloning method Unknown
- 5′ sequencing primer TAATGATCAGCCCACTGACG
- 3′ sequencing primer NA (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
There are some minor discrepancies between Addgene's quality control sequence and the depositor's assembled sequence. No major features or ORFs are disrupted.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pS3 was a gift from Jay Keasling (Addgene plasmid # 50596 ; http://n2t.net/addgene:50596 ; RRID:Addgene_50596) -
For your References section:
Modular engineering of L-tyrosine production in Escherichia coli. Juminaga D, Baidoo EE, Redding-Johanson AM, Batth TS, Burd H, Mukhopadhyay A, Petzold CJ, Keasling JD. Appl Environ Microbiol. 2012 Jan;78(1):89-98. doi: 10.1128/AEM.06017-11. Epub 2011 Oct 21. 10.1128/AEM.06017-11 PubMed 22020510