Skip to main content
Addgene

pX330-Cetn1/1
(Plasmid #50718)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 50718 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pX330
  • Backbone size w/o insert (bp) 8506
  • Vector type
    Mammalian Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    Cetn1 sgRNA1
  • Species
    Synthetic
  • Insert Size (bp)
    20
  • Promoter hU6

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site BbsI (destroyed during cloning)
  • 3′ cloning site BbsI (destroyed during cloning)
  • 5′ sequencing primer tggactatcatatgcttacc
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    humanized S. pyogenes Cas9
  • Alt name
    SpCas9
  • Alt name
    hSpCas9
  • Alt name
    Cas9
  • Species
    S. pyogenes
  • Insert Size (bp)
    4272
  • Promoter CBh
  • Tag / Fusion Protein
    • 3xFLAG (N terminal on insert)

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer pCBhProF2 (5'-agggtttaagggatggttgg-3')
  • 3′ sequencing primer BGH-rev
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    pX330 was obtained from Dr. Feng Zhang before distributed by Addgene.
  • Articles Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pX330-Cetn1/1 was a gift from Masahito Ikawa (Addgene plasmid # 50718 ; http://n2t.net/addgene:50718 ; RRID:Addgene_50718)
  • For your References section:

    Generation of mutant mice by pronuclear injection of circular plasmid expressing Cas9 and single guided RNA. Mashiko D, Fujihara Y, Satouh Y, Miyata H, Isotani A, Ikawa M. Sci Rep. 2013 Nov 27;3:3355. doi: 10.1038/srep03355. 10.1038/srep03355 PubMed 24284873