pX330-Cetn1/1
(Plasmid #50718)

• Purpose: pX330 containing sgRNA against mouse Cent1. Positive control for DSB mediated EGFP reconstitution.
• Depositing Lab: Masahito Ikawa
• Publication: Mashiko et al Sci Rep. 2013 Nov 27;3:3355. doi: 10.1038/srep03355.

Backbone

• Vector backbone: pX330
• Backbone size w/o insert (bp): 8506
• Vector type: Mammalian Expression, CRISPR

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: Cetn1 sgRNA1
• Species: Synthetic
• Insert Size (bp): 20
• Promoter: hU6

Cloning Information for Gene/Insert 1

• Cloning method: Restriction Enzyme
• 5′ cloning site: BbsI (destroyed during cloning)
• 3′ cloning site: BbsI (destroyed during cloning)
• 5′ sequencing primer: tggactatcatatgcttacc

Gene/Insert 2

• Gene/Insert name: humanized S. pyogenes Cas9
• Alt name: SpCas9
• Alt name: hSpCas9
• Alt name: Cas9
• Species: S. pyogenes
• Insert Size (bp): 4272
• Promoter: CBh
• Tag / Fusion Protein:
  • 3xFLAG (N terminal on insert)

Cloning Information for Gene/Insert 2

• Cloning method: Restriction Enzyme
• 5′ cloning site: AgeI (not destroyed)
• 3′ cloning site: EcoRI (not destroyed)
• 5′ sequencing primer: pCBhProF2 (5'-agggtttaagggatggttgg-3')
• 3′ sequencing primer: BGH-rev

Resource Information

• Supplemental Documents:
  • pX330-Cetn1#1
• A portion of this plasmid was derived from a plasmid made by: pX330 was obtained from Dr. Feng Zhang before distributed by Addgene.
• Articles Citing this Plasmid:
  • 6 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry