Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
Holiday Schedule: Addgene will be closed November 28th & 29th for the Thanksgiving holiday. Order processing and shipping may be delayed the week of November 25th - 29th. If you have any questions, please contact us at [email protected].

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #50718)


Item Catalog # Description Quantity Price (USD)
Plasmid 50718 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.


Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    Cetn1 sgRNA1
  • Species
  • Insert Size (bp)
  • Promoter hU6

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site BbsI (destroyed during cloning)
  • 3′ cloning site BbsI (destroyed during cloning)
  • 5′ sequencing primer tggactatcatatgcttacc
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    humanized S. pyogenes Cas9
  • Alt name
  • Alt name
  • Alt name
  • Species
    S. pyogenes
  • Insert Size (bp)
  • Promoter CBh
  • Tag / Fusion Protein
    • 3xFLAG (N terminal on insert)

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer pCBhProF2 (5'-agggtttaagggatggttgg-3')
  • 3′ sequencing primer BGH-rev
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    pX330 was obtained from Dr. Feng Zhang before distributed by Addgene.
  • Terms and Licenses
  • Articles Citing this Plasmid
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pX330-Cetn1/1 was a gift from Masahito Ikawa (Addgene plasmid # 50718 ; ; RRID:Addgene_50718)
  • For your References section:

    Generation of mutant mice by pronuclear injection of circular plasmid expressing Cas9 and single guided RNA. Mashiko D, Fujihara Y, Satouh Y, Miyata H, Isotani A, Ikawa M. Sci Rep. 2013 Nov 27;3:3355. doi: 10.1038/srep03355. 10.1038/srep03355 PubMed 24284873