-
PurposeBicistronic vector expressing mRuby2 and GCaMP6m from a single open reading frame.
-
Depositing Labs
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 51473 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Want a viral vector made from this plasmid?
Make a packaging request and we'll get back to you.
Please log in to submit a packaging request.
-
SerotypeSelect serotype for details See details about
-
PricingSelect serotype and quantity $ USD for preparation of µL virus + $32 USD for plasmid.
-
How this works
- Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
- Addgene will quickly confirm that we can produce a high-quality prep for you.
- Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
- Receive your prep in 6–9 weeks after the MTA is approved by your organization.
- Learn more about our Packaged on Request Service.
Backbone
-
Vector backbonepAAV
- Total vector size (bp) 6756
-
Vector typeAAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Growth instructionsDue to ease of recombination, AAV and lentivirus vectors should be amplified in a recombination deficient bacteria strain such as Invitrogen's OneShot Stbl3 cells. Check for integrety of ITR sites with SmaI digest.
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namemRuby2-P2A-GCaMP6m
-
SpeciesR. norvegicus (rat), G. gallus (chicken); ; A. victoria (jellyfish)
-
Insert Size (bp)2124
- Promoter hSyn1
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer actcagcgctgcctcagtct
- 3′ sequencing primer gtttgtacaaatgatgacagcgaag
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made bymRuby2: Article: Improving FRET dynamic range with bright green and red fluorescent proteins. Lam et al (Nat Methods. 2012 Sep 9. doi: 10.1038/nmeth.2171. PubMed) Addgene Plasmid 40260 GCaMP6s: Article: Ultrasensitive fluorescent proteins for imaging neuronal activity. Chen et al (Nature. 2013 Jul 18;499(7458):295-300. doi: 10.1038/nature12354. PubMed) Addgene Plasmid 40754
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The discrepancies between the full sequence and Addgene's QC sequence should not have any functional consequence.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-hSyn1-mRuby2-GSG-P2A-GCaMP6m-WPRE-pA was a gift from Tobias Bonhoeffer & Mark Huebener & Tobias Rose (Addgene plasmid # 51473 ; http://n2t.net/addgene:51473 ; RRID:Addgene_51473) -
For your References section:
Cell-specific restoration of stimulus preference after monocular deprivation in the visual cortex. Rose T, Jaepel J, Hubener M, Bonhoeffer T. Science. 2016 Jun 10;352(6291):1319-22. doi: 10.1126/science.aad3358. 10.1126/science.aad3358 PubMed 27284193