pLSLT
(Plasmid
#51498)
-
PurposepLSL with T30 TALEN followed by us:NPTII repair template, Rep is not included on this plasmid
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 51498 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCAMBIA1300
- Backbone size w/o insert (bp) 12921
- Total vector size (bp) 20743
-
Modifications to backbonecis-acting replicational elements from the bean yellow dwarf virus were added in an LIR-SIR-LIR orientation.
-
Vector typeplant T-DNA plasmid
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameT30 TALEN pair
-
SpeciesXanthomonas
-
Insert Size (bp)6600
- Promoter virion-sense LIR and 2x35S
Cloning Information for Gene/Insert 1
- Cloning method Gateway Cloning
- 5′ sequencing primer tcattgtctttgttgtgtatt
- 3′ sequencing primer atcaattcccgatctagtaac
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameus:NPTII repair template
-
Insert Size (bp)2600
Cloning Information for Gene/Insert 2
- Cloning method Gateway Cloning
- 5′ sequencing primer gtcttacttccatgatttct
- 3′ sequencing primer tcagaagaactcgtcaagaa
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byT30 TALEN pair was obtained by digesting pZHY528 with restriction enzymes to release the two TALENs. us:NPTII repair template was PCR amplified pDW1269.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Note that Addgene was unable to sequence the RVD region of this plasmid due the repetitive nature of the sequence around it.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLSLT was a gift from Daniel Voytas (Addgene plasmid # 51498 ; http://n2t.net/addgene:51498 ; RRID:Addgene_51498) -
For your References section:
DNA Replicons for Plant Genome Engineering. Baltes NJ, Gil-Humanes J, Cermak T, Atkins PA, Voytas DF. Plant Cell. 2014 Jan;26(1):151-63. doi: 10.1105/tpc.113.119792 10.1105/tpc.113.119792 PubMed 24443519