pLSLZ.D.R
(Plasmid
#51510)
-
PurposeSingle component LSL vector. Contains 2x35S:Zif268:FokI followed by the us:NPTII template. This sequence is between the LIR and SIR.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 51510 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCAMBIA1300
- Backbone size w/o insert (bp) 10531
- Total vector size (bp) 15212
-
Modifications to backbonecis-acting replicational elements from the bean yellow dwarf virus were added in an LIR-SIR-Rep/RepA-LIR orientation.
-
Vector typeplant T-DNA plasmid
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameZif268:FokI
-
Speciesfusion between human and bacterial genes
-
Insert Size (bp)897
- Promoter 2x35S
-
Tag
/ Fusion Protein
- NLS (N terminal on insert)
Cloning Information for Gene/Insert 1
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer atggcttcctcccctccaaaga
- 3′ sequencing primer ctattaaaagtttatctcac
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameus:NPTII repair template
-
Insert Size (bp)2600
Cloning Information for Gene/Insert 2
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer agcagtcttacttccatgatt
- 3′ sequencing primer tcagaagaactcgtcaagaag
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byZif268:FokI and the us:NPTII repair template were amplified by PCR using p35SZ.D as a template.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLSLZ.D.R was a gift from Daniel Voytas (Addgene plasmid # 51510 ; http://n2t.net/addgene:51510 ; RRID:Addgene_51510) -
For your References section:
DNA Replicons for Plant Genome Engineering. Baltes NJ, Gil-Humanes J, Cermak T, Atkins PA, Voytas DF. Plant Cell. 2014 Jan;26(1):151-63. doi: 10.1105/tpc.113.119792 10.1105/tpc.113.119792 PubMed 24443519