-
Purposetransient expression of pcoCas9 gene in plant cells
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 52254 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneHBT-FLAG
-
Vector typeCRISPR ; plant expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namepcoCas9
-
Alt nameplant codon–optimized Cas9
-
SpeciesSynthetic
-
GenBank IDKF264451
- Promoter hybrid constitutive promoter 35SPPDK
-
Tags
/ Fusion Proteins
- FLAG (N terminal on insert)
- NLS (N terminal on insert)
- NLS (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site PstI (not destroyed)
- 5′ sequencing primer sequencing from the promoter: 5’ gtcacgtagtaagcagctctcgg 3’
- 3′ sequencing primer sequencing from the terminator: 5’ atcgcaagaccggcaacagga 3’ (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
HBT-pcoCas9 was a gift from Jen Sheen (Addgene plasmid # 52254 ; http://n2t.net/addgene:52254 ; RRID:Addgene_52254) -
For your References section:
Multiplex and homologous recombination-mediated genome editing in Arabidopsis and Nicotiana benthamiana using guide RNA and Cas9. Li JF, Norville JE, Aach J, McCormack M, Zhang D, Bush J, Church GM, Sheen J. Nat Biotechnol. 2013 Aug;31(8):688-91. doi: 10.1038/nbt.2654. 10.1038/nbt.2654 PubMed 23929339