Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pUC119-gRNA
(Plasmid #52255)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 52255 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    guide RNA targeting AtPDS3
  • Alt name
    PDS3
  • Alt name
    phytoene desaturase 3
  • Species
    A. thaliana (mustard weed)
  • GenBank ID
    KF264452
  • Entrez Gene
    PDS3 (a.k.a. AT4G14210, DL3145C, FCAALL.28, PDE226, PDS, PHYTOENE DESATURASE, PIGMENT DEFECTIVE 226, phytoene desaturase 3)
  • Promoter Arabidopsis U6 polymerase III promoter

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SacI (not destroyed)
  • 3′ cloning site SmaI (destroyed during cloning)
  • 5′ sequencing primer 5’ TGGAATTGTGAGCGGATA 3’
  • 3′ sequencing primer 5’ ATTAAGTTGGGTAACGCC 3'
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

gRNA target sequence GGACTTTTGCCAGCCATGGT

This plasmid is used as a PCR template to assemble new desired guide RNA according to the strategy published in Figure S5 of our Nature Biotechnology paper.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pUC119-gRNA was a gift from Jen Sheen (Addgene plasmid # 52255 ; http://n2t.net/addgene:52255 ; RRID:Addgene_52255)
  • For your References section:

    Multiplex and homologous recombination-mediated genome editing in Arabidopsis and Nicotiana benthamiana using guide RNA and Cas9. Li JF, Norville JE, Aach J, McCormack M, Zhang D, Bush J, Church GM, Sheen J. Nat Biotechnol. 2013 Aug;31(8):688-91. doi: 10.1038/nbt.2654. 10.1038/nbt.2654 PubMed 23929339