-
PurposeCan use a PCR template to assemble new desired guide RNA. Contains an Arabidopsis U6 promoter to drive guide RNA (targeting AtPDS3 gene target site 1) expression with a TTTTTT as terminator.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 52255 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepUC119
- Backbone size w/o insert (bp) 3162
-
Vector typeCRISPR ; Plant expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameguide RNA targeting AtPDS3
-
Alt namePDS3
-
Alt namephytoene desaturase 3
-
SpeciesA. thaliana (mustard weed)
-
GenBank IDKF264452
-
Entrez GenePDS3 (a.k.a. AT4G14210, DL3145C, FCAALL.28, PDE226, PDS, PHYTOENE DESATURASE, PIGMENT DEFECTIVE 226, phytoene desaturase 3)
- Promoter Arabidopsis U6 polymerase III promoter
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SacI (not destroyed)
- 3′ cloning site SmaI (destroyed during cloning)
- 5′ sequencing primer 5’ TGGAATTGTGAGCGGATA 3’
- 3′ sequencing primer 5’ ATTAAGTTGGGTAACGCC 3'
- (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
gRNA target sequence GGACTTTTGCCAGCCATGGT
This plasmid is used as a PCR template to assemble new desired guide RNA according to the strategy published in Figure S5 of our Nature Biotechnology paper.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pUC119-gRNA was a gift from Jen Sheen (Addgene plasmid # 52255 ; http://n2t.net/addgene:52255 ; RRID:Addgene_52255) -
For your References section:
Multiplex and homologous recombination-mediated genome editing in Arabidopsis and Nicotiana benthamiana using guide RNA and Cas9. Li JF, Norville JE, Aach J, McCormack M, Zhang D, Bush J, Church GM, Sheen J. Nat Biotechnol. 2013 Aug;31(8):688-91. doi: 10.1038/nbt.2654. 10.1038/nbt.2654 PubMed 23929339