-
PurposeExpresses recombinant measles virus with Flag-P gene tagged si2 (siP) target sequence
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 58748 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonep(+)MV15894
-
Modifications to backbonePlasmid derived from p(+)MVNSe made in Roberto Cattaneo’s lab. p(+)MVNSe is derived from the original p(+)MV15894 plasmid described by Martin Billeter’s group in Radecke et al., EMBO J 14:5773 (1995) PMID:8846771. p(+)MV15894 contains the Edmonston molecular clone Genebank Z66517 with 13 point mutations including the “tag” AC>GA at positions 1818-9 of the genome, hence its acronym “Edm-tag” and a mutation in P gene resulting in 272Cyst>272Arg mutation into the V coding sequence that disable this protein. p(+)MVNSe is an elongated version of p(+)MV15894 containing the additional sequence CGTACGATGACGTCCTAG inserted just after nt 3368 to introduce unique restriction sites while preserving the genome length to compliance to the rule of six
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)Top10
-
Growth instructionsTransformed bacteria should never be stored at 4°C and should be kept growing at 30°C.
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameMeasles virus antigenome
-
Speciesmeasles virus
-
Insert Size (bp)15996
- Promoter T7
-
Tag
/ Fusion Protein
- Flag (N terminal on insert)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer AACCAGGTCCACACAGC
- 3′ sequencing primer TCTCTGTCATTGTGGAACTT
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Addgene Notes
-
A portion of this plasmid was derived from a plasmid made byOriginal plasmid construct used as backbone was provided by Roberto Cattaneo and Martin Billeter.
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Unique AatII site noted in the Modifications to Backbone field was confirmed by restriction digest. Please see Notes from Addgene link to view results.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
p(+)MV-NSE-FlagP-M502-3p was a gift from Branka Horvat (Addgene plasmid # 58748 ; http://n2t.net/addgene:58748 ; RRID:Addgene_58748)