-
PurposepET21-DCatch encodes Dead streptavidin (negligible biotin binding) bearing a C-terminal SpyCatcher, for generation of chimeric SpyAvidin tetramers
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 59547 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepET21a
-
Backbone manufacturerNovagen
- Backbone size w/o insert (bp) 5400
- Total vector size (bp) 6111
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsDH5alpha for propagation of the plasmid. Bl21[DE3] or similar required for protein expression
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameDead-dloop-Streptavidin-SpyCatcher
-
Alt nameDCatch
-
SpeciesE.Coli
-
Insert Size (bp)711
-
MutationPolyAsp in L3/4 loop for ion-exchange
-
Tag
/ Fusion Protein
- N-terminally shortened SpyCatcher (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NdeI (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer CTAGTTATTGCTCAGCGGTG (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Dead Streptavidin-SpyCatcher was a gift from Mark Howarth (Addgene plasmid # 59547 ; http://n2t.net/addgene:59547 ; RRID:Addgene_59547) -
For your References section:
SpyAvidin hubs enable precise and ultrastable orthogonal nanoassembly. Fairhead M, Veggiani G, Lever M, Yan J, Mesner D, Robinson CV, Dushek O, van der Merwe PA, Howarth M. J Am Chem Soc. 2014 Sep 3;136(35):12355-63. doi: 10.1021/ja505584f. Epub 2014 Aug 21. 10.1021/ja505584f PubMed 25111182