-
PurposeFluorescent FPX sensor for cAMP
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 60936 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepUB2.1
- Total vector size (bp) 9259
-
Vector typeMammalian Expression
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namePKA FPX Sensor
-
SpeciesSynthetic
-
Insert Size (bp)3771
- Promoter CMV
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer atggtgagcaagagcgaggag
- 3′ sequencing primer cttgtaccgctcgtccatgcccag
- (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Contains a dimerization dependent fluorescent protein, originally described by Alford, S.C., Ding, Y., Simmen, T., and Campbell, R.E. (2012). Dimerization-Dependent Green and Yellow Fluorescent Proteins. ACS Synth. Biol. 1, 569–575.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pPHT-PKA was a gift from Anne Marie Quinn (Addgene plasmid # 60936 ; http://n2t.net/addgene:60936 ; RRID:Addgene_60936) -
For your References section:
Ratiometric biosensors based on dimerization-dependent fluorescent protein exchange. Ding Y, Li J, Enterina JR, Shen Y, Zhang I, Tewson PH, Mo GC, Zhang J, Quinn AM, Hughes TE, Maysinger D, Alford SC, Zhang Y, Campbell RE. Nat Methods. 2015 Jan 26. doi: 10.1038/nmeth.3261. 10.1038/nmeth.3261 PubMed 25622108