Skip to main content

TetO-FUW-mir124a
(Plasmid #61539)

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 61539 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    TetO-FUW
  • Backbone size w/o insert (bp) 8376
  • Total vector size (bp) 8688
  • Vector type
    Mammalian Expression, Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    mir124a
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    312
  • Entrez Gene
    MIR124-1 (a.k.a. MIR124A, MIR124A1, MIRN124-1, MIRN124A1, mir-124-1)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer AAGACCACCGCACAGCAAGC
  • 3′ sequencing primer TTCCGCCGTGGCAATAGGGA
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    mir-124a was obtained from Dr. Gail Mandel

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    TetO-FUW-mir124a was a gift from Rudolf Jaenisch (Addgene plasmid # 61539 ; http://n2t.net/addgene:61539 ; RRID:Addgene_61539)
  • For your References section:

    Direct Lineage Conversion of Adult Mouse Liver Cells and B Lymphocytes to Neural Stem Cells. Cassady JP, D'Alessio AC, Sarkar S, Dani VS, Fan ZP, Ganz K, Roessler R, Sur M, Young RA, Jaenisch R. Stem Cell Reports. 2014 Nov 6. pii: S2213-6711(14)00307-5. doi: 10.1016/j.stemcr.2014.10.001. 10.1016/j.stemcr.2014.10.001 PubMed 25454632