px330-gp78
(Plasmid
#61833)
-
Purposeto make gp78 Knockout cell line
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 61833 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepX330-U6-Chimeric_BB-CBh-hSpCas9
-
Backbone manufacturerAddgene
- Backbone size w/o insert (bp) 8506
- Total vector size (bp) 8526
-
Vector typeCRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Top10
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namegp78
-
Alt nameAMFR, RNF45
-
SpeciesH. sapiens (human)
-
Insert Size (bp)20
-
GenBank IDNM_001144.5
-
Entrez GeneAMFR (a.k.a. GP78, RNF45, SPG89)
- Promoter U6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BbsI (destroyed during cloning)
- 3′ cloning site BbsI (destroyed during cloning)
- 5′ sequencing primer CAAGGCTGTTAGAGAGATAATTGGA
- 3′ sequencing primer aggcgggccatttaccgtaa (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Because there is no selective marker, Western blot should be used to screen the knockout clones.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
px330-gp78 was a gift from Yihong Ye (Addgene plasmid # 61833 ; http://n2t.net/addgene:61833 ; RRID:Addgene_61833) -
For your References section:
USP13 antagonizes gp78 to maintain functionality of a chaperone in ER-associated degradation. Liu Y, Soetandyo N, Lee JG, Liu L, Xu Y, Clemons WM Jr, Ye Y. Elife. 2014;3:e01369. doi: 10.7554/eLife.01369. Epub 2014 Jan 14. 10.7554/eLife.01369 PubMed 24424410