-
PurposeC-term SpCas9 piece of inducible split-5 (Cas9(C)-FKBP split-5).
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 62886 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonePX330
-
Backbone manufacturerZhang lab
- Backbone size w/o insert (bp) 4222
- Total vector size (bp) 7087
-
Vector typeMammalian Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameSpCas9 (aa573-1368)
-
Insert Size (bp)2865
- Promoter CBh
-
Tags
/ Fusion Proteins
- NLS SV40 (N terminal on insert)
- FKBP12 (N terminal on insert)
- NLS nucleoplasmin (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Age1 (not destroyed)
- 3′ cloning site EcoR1 (not destroyed)
- 5′ sequencing primer ctggagcacctgcctgaaatcact
- 3′ sequencing primer GGCTGATCAGCGAGCTCTAG
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made bySpCas9 piece was PCR amplified of PX330
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
PX854 was a gift from Feng Zhang (Addgene plasmid # 62886 ; http://n2t.net/addgene:62886 ; RRID:Addgene_62886) -
For your References section:
A split-Cas9 architecture for inducible genome editing and transcription modulation. Zetsche B, Volz SE, Zhang F. Nat Biotechnol. 2015 Feb 2. doi: 10.1038/nbt.3149. 10.1038/nbt.3149 PubMed 25643054