-
PurposepAG414 series plasmid with GPD promoter driving expression of dCas9-VPR; cerevisiae vector
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 63801 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepAG414GPD
-
Vector typeYeast Expression, CRISPR, Synthetic Biology
-
Selectable markersTRP1
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH10B
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namedCas9-VPR
-
Alt nameVP64-p65-Rta
-
SpeciesS. cerevisiae (budding yeast)
-
Insert Size (bp)5733
- Promoter GPD
-
Tag
/ Fusion Protein
- VPR (VP64-p65-Rta) (C terminal on insert)
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer cggtaggtattgattgtaattctg (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Cas9 contains D839A and N863A mutations relative to reference sequence (WP_010922251.1). Depositor states that these mutations do not affect function.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAG414GPD-dCas9-VPR was a gift from George Church (Addgene plasmid # 63801 ; http://n2t.net/addgene:63801 ; RRID:Addgene_63801) -
For your References section:
Highly efficient Cas9-mediated transcriptional programming. Chavez A, Scheiman J, Vora S, Pruitt BW, Tuttle M, P R Iyer E, Lin S, Kiani S, Guzman CD, Wiegand DJ, Ter-Ovanesyan D, Braff JL, Davidsohn N, Housden BE, Perrimon N, Weiss R, Aach J, Collins JJ, Church GM. Nat Methods. 2015 Mar 2. doi: 10.1038/nmeth.3312. 10.1038/nmeth.3312 PubMed 25730490