-
PurposeSP-dCas9 with VP64-p65-Rta (VPR) fused to it's C-terminus; drosophila vector
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 63802 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepAWG
-
Vector typeInsect Expression, CRISPR, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameSP-dCas9-VPR
-
Alt nameVP64-p65-Rta
-
SpeciesD. melanogaster (fly)
-
Insert Size (bp)5733
- Promoter act5c
-
Tag
/ Fusion Protein
- VPR (VP64-p65-Rta) (C terminal on insert)
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer ATCGGCGAACAATTCATACC
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please note that this plasmid contains a stop codon between dCas9-VPR and eGFP and does NOT produce a GFP fusion protein.
Cas9 contains D839A and N863A mutations. Depositor states that these mutations should not affect function.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAWG-dCas9-VPR was a gift from George Church (Addgene plasmid # 63802 ; http://n2t.net/addgene:63802 ; RRID:Addgene_63802) -
For your References section:
Highly efficient Cas9-mediated transcriptional programming. Chavez A, Scheiman J, Vora S, Pruitt BW, Tuttle M, P R Iyer E, Lin S, Kiani S, Guzman CD, Wiegand DJ, Ter-Ovanesyan D, Braff JL, Davidsohn N, Housden BE, Perrimon N, Weiss R, Aach J, Collins JJ, Church GM. Nat Methods. 2015 Mar 2. doi: 10.1038/nmeth.3312. 10.1038/nmeth.3312 PubMed 25730490