Skip to main content
Addgene

pBAD_His B_QuasAr2
(Plasmid #64134)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 64134 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pBAD
  • Backbone size w/o insert (bp) 3974
  • Total vector size (bp) 4754
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    QuasAr2
  • Alt name
    Arch3.77Q
  • Species
    Synthetic
  • Insert Size (bp)
    780

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XbaI (not destroyed)
  • 3′ cloning site HINDIII (not destroyed)
  • 5′ sequencing primer GCTCGTCAATCAAGCTGGTTC
  • 3′ sequencing primer TGGTGAGCAAGGGCTAGAAG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Dr. Yongxin Zhao, Univ. of Alberta

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The N and C termini differ slightly from the mammalian versions of QuasAr1 (Addgene 51629) and QuasAr2 (Addgene 51692), but these differences are not believed to be functionally significant.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pBAD_His B_QuasAr2 was a gift from Adam Cohen (Addgene plasmid # 64134 ; http://n2t.net/addgene:64134 ; RRID:Addgene_64134)
  • For your References section:

    All-optical electrophysiology in mammalian neurons using engineered microbial rhodopsins. Hochbaum DR, Zhao Y, Farhi SL, Klapoetke N, Werley CA, Kapoor V, Zou P, Kralj JM, Maclaurin D, Smedemark-Margulies N, Saulnier JL, Boulting GL, Straub C, Cho YK, Melkonian M, Wong GK, Harrison DJ, Murthy VN, Sabatini BL, Boyden ES, Campbell RE, Cohen AE. Nat Methods. 2014 Aug;11(8):825-33. doi: 10.1038/nmeth.3000. Epub 2014 Jun 22. 10.1038/nmeth.3000 PubMed 24952910